Customer Center
Login | Register

MagPlex-TAG™ Microspheres

These magnetic microspheres allow users to easily design a nucleic acid liquid bead array by hybridizing “TAGed” primers or probes to the surface of the beads

MagPlex-TAG™ Microspheres

MagPlex-TAG Microspheres Regions Available

 

MagPlex-TAG™ Microspheres are oligonucleotide-coupled polystyrene microparticles, or “beads,” that have been dyed into spectrally distinct sets, or “regions,” allowing them to be individually identified by an xMAP® instrument. Each of these uniquely color coded beads has a unique 24 base DNA sequence, called an “anti-TAG,” covalently coupled to its surface. These beads enable you to quickly and easily design custom bead arrays simply by adding a complementary “TAG” sequence to your primers or probes of interest and hybridizing those primers or probes to the anti-TAG sequences on the addressable microsphere.

 

MagPlex-TAG™ Microspheres are magnetic, allowing them to be easily separated from solution with the use of a magnetic separator. This improves percent recovery during handling and wash steps and facilitates assay automation.

 

Additionally, MagPlex-TAG Microspheres are compatible with all xMAP® instruments, including the MAGPIX® system. MAGPIX is simple and easy to use, has a small footprint, and is the most economical multiplex instrument on the market.

 

All microspheres are general use components for further manufacture of xMAP bioassays. MagPlex-TAG Microspheres are available at a concentration of 2.5 million beads/mL and can be ordered in 1 mL vial sizes only. Please contact Luminex to inquire about custom vial sizes.

 

MagPlex-MixTAG80 Microspheres

 

The MagPlex®-MixTAG80 product is a mixture of 80 (Group A & B) MagPlex-TAG Microsphere regions. This product is intended to facilitate the devel­opment of nucleic acid arrays with 80 or less targets. As each microsphere reacts only to nucleotides strands containing their specific complementary TAG sequence, unused regions in assays of less than 80 targets will not be detected by the instrument and not included in the resulting data set.

 

The MagPlex-MixTAG80 product is intended for Luminex® 100/200™ and FLEXMAP 3D® instruments running xPONENT® software only. Although the microsphere mixture can be used with the MAGPIX instrument, MAGPIX will only detect 50 of the 80 regions in the mixture.

 

IMPORTANT: MagPlex-TAG microspheres require the use of xPONENT software.

Features

 

  • 150 Unique 24-mer surface anti-TAG DNA sequences*
  • 150 Regions available (each with unique anti-TAG)*
  • Compatible with all xMAP Instruments
  • 1 mL vial size
  • 2.5 million beads/mL concentration

Benefits

 

  • Proven xTAG® Technology
  • Increased multiplex capability
  • Improved washing efficiency
  • Ideal for automated applications
  • No need for expensive filter plates
  • Convenient 2.5 million bead/mL concentration for easy handling

* MagPlex-TAG Group C regions are built-to-order. Please contact your Luminex representative to inquire about minimum order requirements and lead times for these regions.

Instruments compatible with these microspheres

Luminex® 100/200™Luminex 200 Instrument   MAGPIX®MAGPIX Instrument   FLEXMAP 3D®FLEXMAP 3D Instrument

Ordering Information

 

Luminex Order Management
Email:[email protected]
Phone:1-512-336-3550
Toll Free:1-866-401-5450
Fax:1-512-219-0544
Fax (Europe, Middle East, Asia, India):+31 (0)73 800 1998
Reagent Shipping Policy
Most MagPlex-TAG Microsphere orders, 1 mL volumes, ship within three business days of order receipt. However, backordered items may have longer than normal lead times. MagPlex-TAG Microspheres have a maximum shelf life of two years from the date of manufacture. Group A and B regions have a minimum shelf life of six months from the date of shipment and Group C regions have a minimum shelf life of three months from the ship date. MagPlex-MixTAG80 has a maximum shelf life of 20 months and a minimum guaranteed shelf life of four months. Unfortunately, due to fluctuations in demand, it is not possible to guarantee a longer minimum shelf life for this product. Please see product part numbers below before placing your order, to see which regions are compatible with your instrument.

 

 

Part Numbers

 

To ensure maximum compatibility and availability, new assay developers should always begin with the Group A regions, moving into Group B then Group C regions only when necessary for higher-plex assays.

 

MagPlex-MixTAG80 Product
Part NumberRegion(s)Instrument CompatibilityVolume/Container SizeConcentration
MTAG-MIX80-02Blend of MTAG-AXXX and MTAG-BXXX (80 Regions Total)Luminex 100/200 and FLEXMAP 3D2 mL/4 mL2.5 x 106 beads/mL/region

 

IMPORTANT: MagPlex-TAG Group C regions are built-to-order. Please contact your Luminex representative to inquire about minimum order requirements and lead times for these regions.

 

Available in 1 mL vial sizes only. Please contact Luminex to inquire about custom vial sizes.

 

Reg.Part NumberInstrument CompatibilityAnti-TAG Sequence Bound to Each Microsphere (5′ to 3′)Complementary TAG Sequence (5′ to 3′)
1MTAG-C001FLEXMAP 3D OnlyTATTATGAGAAAGTTGAATAGTAGCTACTATTCAACTTTCTCATAATA
2MTAG-C002FLEXMAP 3D OnlyTATTATGAGAAAGTTGAATAGTAGCTTATCATAAACTCTAACTTTCAT
3MTAG-C003FLEXMAP 3D OnlyAATAGATAAGATTGATTGTGTTTGCAAACACAATCAATCTTATCTATT
4MTAG-C004FLEXMAP 3D OnlyTGTTAAATGTATGTAGTAATTGAGCTCAATTACTACATACATTTAACA
5MTAG-C005FLEXMAP 3D OnlyATAGATTTAAGTGAAGAGAGTTATATAACTCTCTTCACTTAAATCTAT
6MTAG-C006FLEXMAP 3D OnlyGAATGTTTGTAAATGTATAGATAGCTATCTATACATTTACAAACATTC
7MTAG-B007Luminex 100/200 and FLEXMAP 3DAAATTGTGAAAGATTGTTTGTGTATACACAAACAATCTTTCACAATTT
8MTAG-B008Luminex 100/200 and FLEXMAP 3DTGTAAGTGAAATAGTGAGTTATTTAAATAACTCACTATTTCACTTACA
9MTAG-B009Luminex 100/200 and FLEXMAP 3DGAATTGTATAAAGTATTAGATGTGCACATCTAATACTTTATACAATTC
10MTAG-C010FLEXMAP 3D OnlyAGTGAGATTATGAGTATTGATTTATAAATCAATACTCATAATCTCACT
11MTAG-C011FLEXMAP 3D OnlyGTGTAAATGTTTGAGATGTATATTAATATACATCTCAAACATTTACAC
12MTAG-A012All xMAP InstrumentsAGTAGAAAGTTGAAATTGATTATGCATAATCAATTTCAACTTTCTACT
13MTAG-A013All xMAP InstrumentsAGTGAATGTAAGATTATGTATTTGCAAATACATAATCTTACATTCACT
14MTAG-A014All xMAP InstrumentsATTGTGAAAGAAAGAGAAGAAATTAATTTCTTCTCTTTCTTTCACAAT
15MTAG-A015All xMAP InstrumentsGTTGTAAATTGTAGTAAAGAAGTATACTTCTTTACTACAATTTACAAC
16MTAG-C016FLEXMAP 3D OnlyGTAGTAGTAATTTGAATGTTTGAATTCAAACATTCAAATTACTACTAC
17MTAG-C017FLEXMAP 3D OnlyTTGTGAATGATTAATGAATAGAAGCTTCTATTCATTAATCATTCACAA
18MTAG-A018All xMAP InstrumentsGTAATTGAATTGAAAGATAAGTGTACACTTATCTTTCAATTCAATTAC
19MTAG-A019All xMAP InstrumentsGTGTGTTATTTGTTTGTAAAGTATATACTTTACAAACAAATAACACAC
20MTAG-A020All xMAP InstrumentsAAATTAGTTGAAAGTATGAGAAAGCTTTCTCATACTTTCAACTAATTT
21MTAG-A021All xMAP InstrumentsATTAAGTAAGAATTGAGAGTTTGATCAAACTCTCAATTCTTACTTAAT
22MTAG-A022All xMAP InstrumentsGATTGATATTTGAATGTTTGTTTGCAAACAAACATTCAAATATCAATC
23MTAG-C023FLEXMAP 3D OnlyTAGTGTAGATATTTGATAGTTATGCATAACTATCAAATATCTACACTA
24MTAG-C024FLEXMAP 3D OnlyAATAATGTTGTGAAATAGATGTGATCACATCTATTTCACAACATTATT
25MTAG-A025All xMAP InstrumentsGTATGTTGTAATGTATTAAGAAAGCTTTCTTAATACATTACAACATAC
26MTAG-A026All xMAP InstrumentsTTTGATTTAAGAGTGTTGAATGTATACATTCAACACTCTTAAATCAAA
27MTAG-A027All xMAP InstrumentsAAGATGATAGTTAAGTGTAAGTTATAACTTACACTTAACTATCATCTT
28MTAG-A028All xMAP InstrumentsGATAGATTTAGAATGAATTAAGTGCACTTAATTCATTCTAAATCTATC
29MTAG-A029All xMAP InstrumentsTTTAAGTGAGTTATAGAAGTAGTATACTACTTCTATAACTCACTTAAA
30MTAG-A030All xMAP InstrumentsGTGTTATAGAAGTTAAATGTTAAGCTTAACATTTAACTTCTATAACAC
31MTAG-C031FLEXMAP 3D OnlyTAAGAAATGAGTTATATGTTGAGATCTCAACATATAACTCATTTCTTA
32MTAG-C032FLEXMAP 3D OnlyAAGTGTTTAATGTAAGAGAATGAATTCATTCTCTTACATTAAACACTT
33MTAG-A033All xMAP InstrumentsTATTAGAGTTTGAGAATAAGTAGTACTACTTATTCTCAAACTCTAATA
34MTAG-A034All xMAP InstrumentsTGATATAGTAGTGAAGAAATAAGTACTTATTTCTTCACTACTATATCA
35MTAG-A035All xMAP InstrumentsAATAAGAGAATTGATATGAAGATGCATCTTCATATCAATTCTCTTATT
36MTAG-A036All xMAP InstrumentsTTGTGTAGTTAAGAGTTGTTTAATATTAAACAACTCTTAACTACACAA
37MTAG-A037All xMAP InstrumentsTGTATATGTTAATGAGATGTTGTATACAACATCTCATTAACATATACA
38MTAG-A038All xMAP InstrumentsAGTAAGTGTTAGATAGTATTGAATATTCAATACTATCTAACACTTACT
39MTAG-A039All xMAP InstrumentsTTGTGATAGTAGTTAGATATTTGTACAAATATCTAACTACTATCACAA
40MTAG-C040FLEXMAP 3D OnlyAATGTAGAGATTGTAGTGAATATTAATATTCACTACAATCTCTACATT
41MTAG-C041FLEXMAP 3D OnlyATGTAATTGTGAATAATGTATGTGCACATACATTATTCACAATTACAT
42MTAG-A042All xMAP InstrumentsATTTGTTATGATAAATGTGTAGTGCACTACACATTTATCATAACAAAT
43MTAG-A043All xMAP InstrumentsAAATAAGAATAGAGAGAGAAAGTTAACTTTCTCTCTCTATTCTTATTT
44MTAG-A044All xMAP InstrumentsAATGTAAAGTAAAGAAAGTGATGATCATCACTTTCTTTACTTTACATT
45MTAG-A045All xMAP InstrumentsGTTAGTTATGATGAATATTGTGTATACACAATATTCATCATAACTAAC
46MTAG-A046All xMAP InstrumentsGTGATTGAATAGTAGATTGTTTAATTAAACAATCTACTATTCAATCAC
47MTAG-A047All xMAP InstrumentsTATTGTTGAATGTGTTTAAAGAGATCTCTTTAAACACATTCAACAATA
48MTAG-A048All xMAP InstrumentsTATGAATGTTATTGTGTGTTGATTAATCAACACACAATAACATTCATA
49MTAG-B049Luminex 100/200 and FLEXMAP 3DTGTAAGTTTAAAGTAAGAAATGTGCACATTTCTTACTTTAAACTTACA
50MTAG-C050FLEXMAP 3D OnlyAGAGATATTAGAATGTAAGAATAGCTATTCTTACATTCTAATATCTCT
51MTAG-A051All xMAP InstrumentsGATAAGAAAGTGAAATGTAAATTGCAATTTACATTTCACTTTCTTATC
52MTAG-A052All xMAP InstrumentsGTAAGATTAGAAGTTAATGAAGAATTCTTCATTAACTTCTAATCTTAC
53MTAG-A053All xMAP InstrumentsGTTTGTGTTTGTATAAGTTGTTAATTAACAACTTATACAAACACAAAC
54MTAG-A054All xMAP InstrumentsTAGAGAAAGAGAGAATTGTATTAATTAATACAATTCTCTCTTTCTCTA
55MTAG-A055All xMAP InstrumentsGAAGATATTGAAAGAATTTGATGTACATCAAATTCTTTCAATATCTTC
56MTAG-A056All xMAP InstrumentsAATTAGAAGTAAGTAGAGTTTAAGCTTAAACTCTACTTACTTCTAATT
57MTAG-A057All xMAP InstrumentsAGAGTATTAGTAGTTATTGTAAGTACTTACAATAACTACTAATACTCT
58MTAG-B058Luminex 100/200 and FLEXMAP 3DTGAGAATGTAAAGAATGTTTATTGCAATAAACATTCTTTACATTCTCA
59MTAG-B059Luminex 100/200 and FLEXMAP 3DATTTAAGTAAAGTGTAGAGATAAGCTTATCTCTACACTTTACTTAAAT
60MTAG-C060FLEXMAP 3D OnlyGTTATGTAGAGATGAAAGAAATTATAATTTCTTTCATCTCTACATAAC
61MTAG-A061All xMAP InstrumentsTATTAGAGAGAAATTGTAGAGATTAATCTCTACAATTTCTCTCTAATA
62MTAG-A062All xMAP InstrumentsTGAAATGTGTATTTGTATGTTTAGCTAAACATACAAATACACATTTCA
63MTAG-A063All xMAP InstrumentsTTTGTTGTTAAGTATGTGATTTAGCTAAATCACATACTTAACAACAAA
64MTAG-A064All xMAP InstrumentsATGATGTGTTTGATTTGAATTGAATTCAATTCAAATCAAACACATCAT
65MTAG-A065All xMAP InstrumentsTGAGTAAGTTTGTATGTTTAAGTATACTTAAACATACAAACTTACTCA
66MTAG-A066All xMAP InstrumentsGTAAGAGTATTGAAATTAGTAAGATCTTACTAATTTCAATACTCTTAC
67MTAG-A067All xMAP InstrumentsTTTGTGTGTTATTGTAATTGAGATATCTCAATTACAATAACACACAAA
68MTAG-B068Luminex 100/200 and FLEXMAP 3DTATTTGATAAGAGAATGAAGAAGTACTTCTTCATTCTCTTATCAAATA
69MTAG-B069Luminex 100/200 and FLEXMAP 3DATGAAAGATTTAGTTGTGAGATATATATCTCACAACTAAATCTTTCAT
70MTAG-B070Luminex 100/200 and FLEXMAP 3DGATTAGTATTTAGTAGTAATAGAGCTCTATTACTACTAAATACTAATC
71MTAG-C071FLEXMAP 3D OnlyGTGATAGAATTTGTGTTTAATGAATTCATTAAACACAAATTCTATCAC
72MTAG-A072All xMAP InstrumentsAATTGAGAAAGAGATAAATGATAGCTATCATTTATCTCTTTCTCAATT
73MTAG-A073All xMAP InstrumentsGTTGAGAATTAGAATTTGATAAAGCTTTATCAAATTCTAATTCTCAAC
74MTAG-A074All xMAP InstrumentsAATGAAATAGTGTTAAATGAGTGTACACTCATTTAACACTATTTCATT
75MTAG-A075All xMAP InstrumentsTTTGTTAGAATGAGAAGATTTATGCATAAATCTTCTCATTCTAACAAA
76MTAG-A076All xMAP InstrumentsAAAGAATTAGTATGATAGATGAGATCTCATCTATCATACTAATTCTTT
77MTAG-A077All xMAP InstrumentsGTTATGATATAGTGAGTTGTTATTAATAACAACTCACTATATCATAAC
78MTAG-A078All xMAP InstrumentsGTATAGTGTGATTAGATTTGTAAATTTACAAATCTAATCACACTATAC
79MTAG-B079Luminex 100/200 and FLEXMAP 3DTAGTAGAATTGTTGTTAAAGAATGCATTCTTTAACAACAATTCTACTA
80MTAG-B080Luminex 100/200 and FLEXMAP 3DGATGAATATAGTAAGTATTGAGTATACTCAATACTTACTATATTCATC
81MTAG-B081Luminex 100/200 and FLEXMAP 3DGTGAATAATGAAGAAGTTATGTTATAACATAACTTCTTCATTATTCAC
82MTAG-B082Luminex 100/200 and FLEXMAP 3DATTTGTATAAAGTGAAGAAGAGAATTCTCTTCTTCACTTTATACAAAT
83MTAG-B083Luminex 100/200 and FLEXMAP 3DGAAAGTTTAAGTGATGTATATTGTACAATATACATCACTTAAACTTTC
84MTAG-B084Luminex 100/200 and FLEXMAP 3DTGAATTGAATAAGAATTTGTTGTGCACAACAAATTCTTATTCAATTCA
85MTAG-B085Luminex 100/200 and FLEXMAP 3DGTTATGAAAGAGTATGTGTTAAATATTTAACACATACTCTTTCATAAC
86MTAG-B086Luminex 100/200 and FLEXMAP 3DGTGTGATTAGTAATGAAGTATTTATAAATACTTCATTACTAATCACAC
87MTAG-B087Luminex 100/200 and FLEXMAP 3DGTTTGTTGAAAGTGTAAAGTATATATATACTTTACACTTTCAACAAAC
88MTAG-B088Luminex 100/200 and FLEXMAP 3DAAAGATAAAGTTAAGTGTTTGTAGCTACAAACACTTAACTTTATCTTT
89MTAG-B089Luminex 100/200 and FLEXMAP 3DTAGATAATGTGAAGTAATAAGTGATCACTTATTACTTCACATTATCTA
90MTAG-B090Luminex 100/200 and FLEXMAP 3DTAGATTAGTTGATAAGTGTGTAATATTACACACTTATCAACTAATCTA
91MTAG-B091Luminex 100/200 and FLEXMAP 3DGTTTAGTGATTAAAGATAGATTAGCTAATCTATCTTTAATCACTAAAC
92MTAG-C092FLEXMAP 3D OnlyAGATAAAGAGATTTAAGATGTATGCATACATCTTAAATCTCTTTATCT
93MTAG-B093Luminex 100/200 and FLEXMAP 3DAGAGAGTTTGTGTATATGTATAAATTTATACATATACACAAACTCTCT
94MTAG-B094Luminex 100/200 and FLEXMAP 3DGTAGTAAAGAGAATTGTTTAGTATATACTAAACAATTCTCTTTACTAC
95MTAG-B095Luminex 100/200 and FLEXMAP 3DTGATGTGATAATGAGAATAAAGAATTCTTTATTCTCATTATCACATCA
96MTAG-B096Luminex 100/200 and FLEXMAP 3DTATGTGTATGAAGATTATAGTTAGCTAACTATAATCTTCATACACATA
97MTAG-B097Luminex 100/200 and FLEXMAP 3DTGAAATAGAAGTGAGATTATAGTATACTATAATCTCACTTCTATTTCA
98MTAG-B098Luminex 100/200 and FLEXMAP 3DAAATGTGTGTTTAGTAGTTGTAAATTTACAACTACTAAACACACATTT
99MTAG-B099Luminex 100/200 and FLEXMAP 3DGTTAGAATGTATATAGAGTTAGATATCTAACTCTATATACATTCTAAC
100MTAG-B100Luminex 100/200 and FLEXMAP 3DTTAAGAAGAATTGTATATGAGAGTACTCTCATATACAATTCTTCTTAA
101MTAG-C101FLEXMAP 3D OnlyTTTAGAGTTTGATTAGTATGTTTGCAAACATACTAATCAAACTCTAAA
102MTAG-C102FLEXMAP 3D OnlyAATGAATAGAATAGAGAATGTAGATCTACATTCTCTATTCTATTCATT
103MTAG-C103FLEXMAP 3D OnlyGATGTATAATGATGTGTGTAAATTAATTTACACACATCATTATACATC
104MTAG-C104FLEXMAP 3D OnlyTAAAGAGTGATGTAAATAGAAGTTAACTTCTATTTACATCACTCTTTA
105MTAG-C105FLEXMAP 3D OnlyTGTAGTGTTTAGAGTAAGTTATTATAATAACTTACTCTAAACACTACA
106MTAG-C106FLEXMAP 3D OnlyGTAATAAGTTGTGAAAGAAGATTATAATCTTCTTTCACAACTTATTAC
107MTAG-C107FLEXMAP 3D OnlyTTTAGTTGATTGTTGAATAGAGTATACTCTATTCAACAATCAACTAAA
108MTAG-C108FLEXMAP 3D OnlyATTATTGAAAGTAGATGTTAGATGCATCTAACATCTACTTTCAATAAT
109MTAG-C109FLEXMAP 3D OnlyTTTATGTGTGATTGAGTGTTTAATATTAAACACTCAATCACACATAAA
110MTAG-C110FLEXMAP 3D OnlyTATTTAGTTAGATAGATAGAGAGTACTCTCTATCTATCTAACTAAATA
111MTAG-C111FLEXMAP 3D OnlyATGTGTTTATGTGAAAGATTTGTATACAAATCTTTCACATAAACACAT
112MTAG-C112FLEXMAP 3D OnlyTATGAGTGATTAGAATTGTATTTGCAAATACAATTCTAATCACTCATA
113MTAG-C113FLEXMAP 3D OnlyTTAATGTATTGTTTAAAGAGTGTGCACACTCTTTAAACAATACATTAA
114MTAG-C114FLEXMAP 3D OnlyGTTATAAGTAGAAATGTATAGAAGCTTCTATACATTTCTACTTATAAC
115MTAG-C115FLEXMAP 3D OnlyGAGAATGTTGAATAAGAAGTAATTAATTACTTCTTATTCAACATTCTC
116MTAG-C116FLEXMAP 3D OnlyAGTTATAAGTAAATGATGTTGATGCATCAACATCATTTACTTATAACT
117MTAG-C117FLEXMAP 3D OnlyTTGTATGTGAGTTTAGATTAATGATCATTAATCTAAACTCACATACAA
118MTAG-C118FLEXMAP 3D OnlyTAGTTAAAGTATAGTTGTTTGAGTACTCAAACAACTATACTTTAACTA
119MTAG-C119FLEXMAP 3D OnlyAAATTTGTGTTGAGATTTGTATAGCTATACAAATCTCAACACAAATTT
120MTAG-C120FLEXMAP 3D OnlyTATAAGAAGTAATTTGAGAAGAGTACTCTTCTCAAATTACTTCTTATA
121MTAG-C121FLEXMAP 3D OnlyTTTGATTTATGTGTTATGTTGAGTACTCAACATAACACATAAATCAAA
122MTAG-C122FLEXMAP 3D OnlyAGATTGAAATAGATTAGAAAGTTGCAACTTTCTAATCTATTTCAATCT
123MTAG-C123FLEXMAP 3D OnlyGTTGTTATAAGAAATAGTTTGTTGCAACAAACTATTTCTTATAACAAC
124MTAG-C124FLEXMAP 3D OnlyAAGAAGTAAGAGAGAAATTTGAATATTCAAATTTCTCTCTTACTTCTT
125MTAG-C125FLEXMAP 3D OnlyAGATAAGTTAAAGTAAAGAGAATGCATTCTCTTTACTTTAACTTATCT
126MTAG-C126FLEXMAP 3D OnlyTAGTTGAAGTTAGTTTAAGTGTTATAACACTTAAACTAACTTCAACTA
127MTAG-C127FLEXMAP 3D OnlyAGTAAGAATGTAATATGATGATAGCTATCATCATATTACATTCTTACT
128MTAG-C128FLEXMAP 3D OnlyAGTTAGTAAGAGAATATAGTGAATATTCACTATATTCTCTTACTAACT
129MTAG-C129FLEXMAP 3D OnlyATTGTGTTTAAGAAATATGATGAGCTCATCATATTTCTTAAACACAAT
130MTAG-C130FLEXMAP 3D OnlyATTTGTGTGATGTTTGAAATATGATCATATTTCAAACATCACACAAAT
131MTAG-C131FLEXMAP 3D OnlyAGAGAAATTGAATTTAGAAATGTGCACATTTCTAAATTCAATTTCTCT
132MTAG-C132FLEXMAP 3D OnlyTTAGAAGATAGATTATTGAGAAAGCTTTCTCAATAATCTATCTTCTAA
133MTAG-C133FLEXMAP 3D OnlyAGTAAGAAAGTTTAGTTTAGTTAGCTAACTAAACTAAACTTTCTTACT
134MTAG-C134FLEXMAP 3D OnlyTTAGATTAGAGTAGTAGAAGAATATATTCTTCTACTACTCTAATCTAA
135MTAG-C135FLEXMAP 3D OnlyTTAAAGATGTTAAAGAATGAGTGATCACTCATTCTTTAACATCTTTAA
136MTAG-C136FLEXMAP 3D OnlyTGTAGTATGAAGAATAATGAAATGCATTTCATTATTCTTCATACTACA
137MTAG-C137FLEXMAP 3D OnlyATTTAGAGTTGTAAGAAGATATTGCAATATCTTCTTACAACTCTAAAT
138MTAG-C138FLEXMAP 3D OnlyGAGAAATTGTAATTGTTAGAGTATATACTCTAACAATTACAATTTCTC
139MTAG-C139FLEXMAP 3D OnlyAATATTGAAGATGTAGTGAGTTATATAACTCACTACATCTTCAATATT
140MTAG-C140FLEXMAP 3D OnlyGAGTTTAGAAATGATAAAGAATTGCAATTCTTTATCATTTCTAAACTC
141MTAG-C141FLEXMAP 3D OnlyTGAGTAAATAGTTTATGAGTAGTATACTACTCATAAACTATTTACTCA
142MTAG-C142FLEXMAP 3D OnlyTTTAGTTTGATGTGTTTATGAGATATCTCATAAACACATCAAACTAAA
143MTAG-C143FLEXMAP 3D OnlyTAGTTGAATAAGATTGAGAGAAATATTTCTCTCAATCTTATTCAACTA
144MTAG-C144FLEXMAP 3D OnlyTTAAGTGAAGTGTTGTTTATTGAATTCAATAAACAACACTTCACTTAA
145MTAG-C145FLEXMAP 3D OnlyATTGATTTGTTGAAATAAGTGTTGCAACACTTATTTCAACAAATCAAT
146MTAG-C146FLEXMAP 3D OnlyTGAATTGTTGATAAGTTATGAAGA;TCTTCATAACTTATCAACAATTCA
147MTAG-C147FLEXMAP 3D OnlyTGATTTAGTATGTATTAGAGTTGATCAACTCTAATACATACTAAATCA
148MTAG-C148FLEXMAP 3D OnlyATTTATGTAGTTGAGAGTGATAAATTTATCACTCTCAACTACATAAAT
149MTAG-C149FLEXMAP 3D OnlyGTAAAGATAGTTTGAGTAATTTGATCAAATTACTCAAACTATCTTTAC
150MTAG-C150FLEXMAP 3D OnlyGAAATAGTATAATGTTAAGTGAGATCTCACTTAACATTATACTATTTC