Customer Center
Login | Register

MagPlex-TAG™ Microspheres

These magnetic microspheres allow users to easily design a nucleic acid liquid bead array by hybridizing “TAGed” primers or probes to the surface of the beads

MagPlex-TAG™ Microspheres

MagPlex-TAG Microspheres Regions Available

 

MagPlex-TAG™ Microspheres are oligonucleotide-coupled polystyrene microparticles, or “beads,” that have been dyed into spectrally distinct sets, or “regions,” allowing them to be individually identified by an xMAP® instrument. Each of these uniquely color coded beads has a unique 24 base DNA sequence, called an “anti-TAG,” covalently coupled to its surface. These beads enable you to quickly and easily design custom bead arrays simply by adding a complementary “TAG” sequence to your primers or probes of interest and hybridizing those primers or probes to the anti-TAG sequences on the addressable microsphere.

 

MagPlex-TAG™ Microspheres are magnetic, allowing them to be easily separated from solution with the use of a magnetic separator. This improves percent recovery during handling and wash steps and facilitates assay automation.

 

Additionally, MagPlex-TAG Microspheres are compatible with all xMAP® instruments, including the MAGPIX® system. MAGPIX is simple and easy to use, has a small footprint, and is the most economical multiplex instrument on the market.

 

All microspheres are general use components for further manufacture of xMAP bioassays. MagPlex-TAG Microspheres are available at a concentration of 2.5 million beads/mL and can be ordered in 1 mL vial sizes only. Please contact Luminex to inquire about custom vial sizes.

 

MagPlex-MixTAG80 Microspheres

 

The MagPlex®-MixTAG80 product is a mixture of 80 (Group A & B) MagPlex-TAG Microsphere regions. This product is intended to facilitate the devel­opment of nucleic acid arrays with 80 or less targets. As each microsphere reacts only to nucleotides strands containing their specific complementary TAG sequence, unused regions in assays of less than 80 targets will not be detected by the instrument and not included in the resulting data set.

 

The MagPlex-MixTAG80 product is intended for Luminex® 100/200™ and FLEXMAP 3D® instruments running xPONENT® software only. Although the microsphere mixture can be used with the MAGPIX instrument, MAGPIX will only detect 50 of the 80 regions in the mixture.

 

IMPORTANT: MagPlex-TAG microspheres require the use of xPONENT software.

Features

 

  • 150 Unique 24-mer surface anti-TAG DNA sequences*
  • 150 Regions available (each with unique anti-TAG)*
  • Compatible with all xMAP Instruments
  • 1 mL vial size
  • 2.5 million beads/mL concentration

Benefits

 

  • Proven xTAG® Technology
  • Increased multiplex capability
  • Improved washing efficiency
  • Ideal for automated applications
  • No need for expensive filter plates
  • Convenient 2.5 million bead/mL concentration for easy handling

* MagPlex-TAG Group C regions are built-to-order. Please contact your Luminex representative to inquire about minimum order requirements and lead times for these regions.

Instruments compatible with these microspheres

Luminex® 100/200™Luminex 200 Instrument   MAGPIX®MAGPIX Instrument   FLEXMAP 3D®FLEXMAP 3D Instrument

Ordering Information

 

Luminex Order Management
Email: [email protected]
Phone: +31 (0)73 800 1900
Fax: +31 (0)73 800 1998
Reagent Shipping Policy
Most MagPlex-TAG Microsphere orders, 1 mL volumes, ship within three business days of order receipt. However, backordered items may have longer than normal lead times. MagPlex-TAG Microspheres have a maximum shelf life of two years from the date of manufacture. Group A and B regions have a minimum shelf life of six months from the date of shipment and Group C regions have a minimum shelf life of three months from the ship date. MagPlex-MixTAG80 has a maximum shelf life of 20 months and a minimum guaranteed shelf life of four months. Unfortunately, due to fluctuations in demand, it is not possible to guarantee a longer minimum shelf life for this product. Please see product part numbers below before placing your order, to see which regions are compatible with your instrument.

 

 

Part Numbers

 

To ensure maximum compatibility and availability, new assay developers should always begin with the Group A regions, moving into Group B then Group C regions only when necessary for higher-plex assays.

 

MagPlex-MixTAG80 Product
Part Number Region(s) Instrument Compatibility Volume/Container Size Concentration
MTAG-MIX80-02 Blend of MTAG-AXXX and MTAG-BXXX (80 Regions Total) Luminex 100/200 and FLEXMAP 3D 2 mL/4 mL 2.5 x 106 beads/mL/region

 

IMPORTANT: MagPlex-TAG Group C regions are built-to-order. Please contact your Luminex representative to inquire about minimum order requirements and lead times for these regions.

 

Available in 1 mL vial sizes only. Please contact Luminex to inquire about custom vial sizes.

 

Reg. Part Number Instrument Compatibility Anti-TAG Sequence Bound to Each Microsphere (5′ to 3′) Complementary TAG Sequence (5′ to 3′)
1 MTAG-C001 FLEXMAP 3D Only TATTATGAGAAAGTTGAATAGTAG CTACTATTCAACTTTCTCATAATA
2 MTAG-C002 FLEXMAP 3D Only TATTATGAGAAAGTTGAATAGTAG CTTATCATAAACTCTAACTTTCAT
3 MTAG-C003 FLEXMAP 3D Only AATAGATAAGATTGATTGTGTTTG CAAACACAATCAATCTTATCTATT
4 MTAG-C004 FLEXMAP 3D Only TGTTAAATGTATGTAGTAATTGAG CTCAATTACTACATACATTTAACA
5 MTAG-C005 FLEXMAP 3D Only ATAGATTTAAGTGAAGAGAGTTAT ATAACTCTCTTCACTTAAATCTAT
6 MTAG-C006 FLEXMAP 3D Only GAATGTTTGTAAATGTATAGATAG CTATCTATACATTTACAAACATTC
7 MTAG-B007 Luminex 100/200 and FLEXMAP 3D AAATTGTGAAAGATTGTTTGTGTA TACACAAACAATCTTTCACAATTT
8 MTAG-B008 Luminex 100/200 and FLEXMAP 3D TGTAAGTGAAATAGTGAGTTATTT AAATAACTCACTATTTCACTTACA
9 MTAG-B009 Luminex 100/200 and FLEXMAP 3D GAATTGTATAAAGTATTAGATGTG CACATCTAATACTTTATACAATTC
10 MTAG-C010 FLEXMAP 3D Only AGTGAGATTATGAGTATTGATTTA TAAATCAATACTCATAATCTCACT
11 MTAG-C011 FLEXMAP 3D Only GTGTAAATGTTTGAGATGTATATT AATATACATCTCAAACATTTACAC
12 MTAG-A012 All xMAP Instruments AGTAGAAAGTTGAAATTGATTATG CATAATCAATTTCAACTTTCTACT
13 MTAG-A013 All xMAP Instruments AGTGAATGTAAGATTATGTATTTG CAAATACATAATCTTACATTCACT
14 MTAG-A014 All xMAP Instruments ATTGTGAAAGAAAGAGAAGAAATT AATTTCTTCTCTTTCTTTCACAAT
15 MTAG-A015 All xMAP Instruments GTTGTAAATTGTAGTAAAGAAGTA TACTTCTTTACTACAATTTACAAC
16 MTAG-C016 FLEXMAP 3D Only GTAGTAGTAATTTGAATGTTTGAA TTCAAACATTCAAATTACTACTAC
17 MTAG-C017 FLEXMAP 3D Only TTGTGAATGATTAATGAATAGAAG CTTCTATTCATTAATCATTCACAA
18 MTAG-A018 All xMAP Instruments GTAATTGAATTGAAAGATAAGTGT ACACTTATCTTTCAATTCAATTAC
19 MTAG-A019 All xMAP Instruments GTGTGTTATTTGTTTGTAAAGTAT ATACTTTACAAACAAATAACACAC
20 MTAG-A020 All xMAP Instruments AAATTAGTTGAAAGTATGAGAAAG CTTTCTCATACTTTCAACTAATTT
21 MTAG-A021 All xMAP Instruments ATTAAGTAAGAATTGAGAGTTTGA TCAAACTCTCAATTCTTACTTAAT
22 MTAG-A022 All xMAP Instruments GATTGATATTTGAATGTTTGTTTG CAAACAAACATTCAAATATCAATC
23 MTAG-C023 FLEXMAP 3D Only TAGTGTAGATATTTGATAGTTATG CATAACTATCAAATATCTACACTA
24 MTAG-C024 FLEXMAP 3D Only AATAATGTTGTGAAATAGATGTGA TCACATCTATTTCACAACATTATT
25 MTAG-A025 All xMAP Instruments GTATGTTGTAATGTATTAAGAAAG CTTTCTTAATACATTACAACATAC
26 MTAG-A026 All xMAP Instruments TTTGATTTAAGAGTGTTGAATGTA TACATTCAACACTCTTAAATCAAA
27 MTAG-A027 All xMAP Instruments AAGATGATAGTTAAGTGTAAGTTA TAACTTACACTTAACTATCATCTT
28 MTAG-A028 All xMAP Instruments GATAGATTTAGAATGAATTAAGTG CACTTAATTCATTCTAAATCTATC
29 MTAG-A029 All xMAP Instruments TTTAAGTGAGTTATAGAAGTAGTA TACTACTTCTATAACTCACTTAAA
30 MTAG-A030 All xMAP Instruments GTGTTATAGAAGTTAAATGTTAAG CTTAACATTTAACTTCTATAACAC
31 MTAG-C031 FLEXMAP 3D Only TAAGAAATGAGTTATATGTTGAGA TCTCAACATATAACTCATTTCTTA
32 MTAG-C032 FLEXMAP 3D Only AAGTGTTTAATGTAAGAGAATGAA TTCATTCTCTTACATTAAACACTT
33 MTAG-A033 All xMAP Instruments TATTAGAGTTTGAGAATAAGTAGT ACTACTTATTCTCAAACTCTAATA
34 MTAG-A034 All xMAP Instruments TGATATAGTAGTGAAGAAATAAGT ACTTATTTCTTCACTACTATATCA
35 MTAG-A035 All xMAP Instruments AATAAGAGAATTGATATGAAGATG CATCTTCATATCAATTCTCTTATT
36 MTAG-A036 All xMAP Instruments TTGTGTAGTTAAGAGTTGTTTAAT ATTAAACAACTCTTAACTACACAA
37 MTAG-A037 All xMAP Instruments TGTATATGTTAATGAGATGTTGTA TACAACATCTCATTAACATATACA
38 MTAG-A038 All xMAP Instruments AGTAAGTGTTAGATAGTATTGAAT ATTCAATACTATCTAACACTTACT
39 MTAG-A039 All xMAP Instruments TTGTGATAGTAGTTAGATATTTGT ACAAATATCTAACTACTATCACAA
40 MTAG-C040 FLEXMAP 3D Only AATGTAGAGATTGTAGTGAATATT AATATTCACTACAATCTCTACATT
41 MTAG-C041 FLEXMAP 3D Only ATGTAATTGTGAATAATGTATGTG CACATACATTATTCACAATTACAT
42 MTAG-A042 All xMAP Instruments ATTTGTTATGATAAATGTGTAGTG CACTACACATTTATCATAACAAAT
43 MTAG-A043 All xMAP Instruments AAATAAGAATAGAGAGAGAAAGTT AACTTTCTCTCTCTATTCTTATTT
44 MTAG-A044 All xMAP Instruments AATGTAAAGTAAAGAAAGTGATGA TCATCACTTTCTTTACTTTACATT
45 MTAG-A045 All xMAP Instruments GTTAGTTATGATGAATATTGTGTA TACACAATATTCATCATAACTAAC
46 MTAG-A046 All xMAP Instruments GTGATTGAATAGTAGATTGTTTAA TTAAACAATCTACTATTCAATCAC
47 MTAG-A047 All xMAP Instruments TATTGTTGAATGTGTTTAAAGAGA TCTCTTTAAACACATTCAACAATA
48 MTAG-A048 All xMAP Instruments TATGAATGTTATTGTGTGTTGATT AATCAACACACAATAACATTCATA
49 MTAG-B049 Luminex 100/200 and FLEXMAP 3D TGTAAGTTTAAAGTAAGAAATGTG CACATTTCTTACTTTAAACTTACA
50 MTAG-C050 FLEXMAP 3D Only AGAGATATTAGAATGTAAGAATAG CTATTCTTACATTCTAATATCTCT
51 MTAG-A051 All xMAP Instruments GATAAGAAAGTGAAATGTAAATTG CAATTTACATTTCACTTTCTTATC
52 MTAG-A052 All xMAP Instruments GTAAGATTAGAAGTTAATGAAGAA TTCTTCATTAACTTCTAATCTTAC
53 MTAG-A053 All xMAP Instruments GTTTGTGTTTGTATAAGTTGTTAA TTAACAACTTATACAAACACAAAC
54 MTAG-A054 All xMAP Instruments TAGAGAAAGAGAGAATTGTATTAA TTAATACAATTCTCTCTTTCTCTA
55 MTAG-A055 All xMAP Instruments GAAGATATTGAAAGAATTTGATGT ACATCAAATTCTTTCAATATCTTC
56 MTAG-A056 All xMAP Instruments AATTAGAAGTAAGTAGAGTTTAAG CTTAAACTCTACTTACTTCTAATT
57 MTAG-A057 All xMAP Instruments AGAGTATTAGTAGTTATTGTAAGT ACTTACAATAACTACTAATACTCT
58 MTAG-B058 Luminex 100/200 and FLEXMAP 3D TGAGAATGTAAAGAATGTTTATTG CAATAAACATTCTTTACATTCTCA
59 MTAG-B059 Luminex 100/200 and FLEXMAP 3D ATTTAAGTAAAGTGTAGAGATAAG CTTATCTCTACACTTTACTTAAAT
60 MTAG-C060 FLEXMAP 3D Only GTTATGTAGAGATGAAAGAAATTA TAATTTCTTTCATCTCTACATAAC
61 MTAG-A061 All xMAP Instruments TATTAGAGAGAAATTGTAGAGATT AATCTCTACAATTTCTCTCTAATA
62 MTAG-A062 All xMAP Instruments TGAAATGTGTATTTGTATGTTTAG CTAAACATACAAATACACATTTCA
63 MTAG-A063 All xMAP Instruments TTTGTTGTTAAGTATGTGATTTAG CTAAATCACATACTTAACAACAAA
64 MTAG-A064 All xMAP Instruments ATGATGTGTTTGATTTGAATTGAA TTCAATTCAAATCAAACACATCAT
65 MTAG-A065 All xMAP Instruments TGAGTAAGTTTGTATGTTTAAGTA TACTTAAACATACAAACTTACTCA
66 MTAG-A066 All xMAP Instruments GTAAGAGTATTGAAATTAGTAAGA TCTTACTAATTTCAATACTCTTAC
67 MTAG-A067 All xMAP Instruments TTTGTGTGTTATTGTAATTGAGAT ATCTCAATTACAATAACACACAAA
68 MTAG-B068 Luminex 100/200 and FLEXMAP 3D TATTTGATAAGAGAATGAAGAAGT ACTTCTTCATTCTCTTATCAAATA
69 MTAG-B069 Luminex 100/200 and FLEXMAP 3D ATGAAAGATTTAGTTGTGAGATAT ATATCTCACAACTAAATCTTTCAT
70 MTAG-B070 Luminex 100/200 and FLEXMAP 3D GATTAGTATTTAGTAGTAATAGAG CTCTATTACTACTAAATACTAATC
71 MTAG-C071 FLEXMAP 3D Only GTGATAGAATTTGTGTTTAATGAA TTCATTAAACACAAATTCTATCAC
72 MTAG-A072 All xMAP Instruments AATTGAGAAAGAGATAAATGATAG CTATCATTTATCTCTTTCTCAATT
73 MTAG-A073 All xMAP Instruments GTTGAGAATTAGAATTTGATAAAG CTTTATCAAATTCTAATTCTCAAC
74 MTAG-A074 All xMAP Instruments AATGAAATAGTGTTAAATGAGTGT ACACTCATTTAACACTATTTCATT
75 MTAG-A075 All xMAP Instruments TTTGTTAGAATGAGAAGATTTATG CATAAATCTTCTCATTCTAACAAA
76 MTAG-A076 All xMAP Instruments AAAGAATTAGTATGATAGATGAGA TCTCATCTATCATACTAATTCTTT
77 MTAG-A077 All xMAP Instruments GTTATGATATAGTGAGTTGTTATT AATAACAACTCACTATATCATAAC
78 MTAG-A078 All xMAP Instruments GTATAGTGTGATTAGATTTGTAAA TTTACAAATCTAATCACACTATAC
79 MTAG-B079 Luminex 100/200 and FLEXMAP 3D TAGTAGAATTGTTGTTAAAGAATG CATTCTTTAACAACAATTCTACTA
80 MTAG-B080 Luminex 100/200 and FLEXMAP 3D GATGAATATAGTAAGTATTGAGTA TACTCAATACTTACTATATTCATC
81 MTAG-B081 Luminex 100/200 and FLEXMAP 3D GTGAATAATGAAGAAGTTATGTTA TAACATAACTTCTTCATTATTCAC
82 MTAG-B082 Luminex 100/200 and FLEXMAP 3D ATTTGTATAAAGTGAAGAAGAGAA TTCTCTTCTTCACTTTATACAAAT
83 MTAG-B083 Luminex 100/200 and FLEXMAP 3D GAAAGTTTAAGTGATGTATATTGT ACAATATACATCACTTAAACTTTC
84 MTAG-B084 Luminex 100/200 and FLEXMAP 3D TGAATTGAATAAGAATTTGTTGTG CACAACAAATTCTTATTCAATTCA
85 MTAG-B085 Luminex 100/200 and FLEXMAP 3D GTTATGAAAGAGTATGTGTTAAAT ATTTAACACATACTCTTTCATAAC
86 MTAG-B086 Luminex 100/200 and FLEXMAP 3D GTGTGATTAGTAATGAAGTATTTA TAAATACTTCATTACTAATCACAC
87 MTAG-B087 Luminex 100/200 and FLEXMAP 3D GTTTGTTGAAAGTGTAAAGTATAT ATATACTTTACACTTTCAACAAAC
88 MTAG-B088 Luminex 100/200 and FLEXMAP 3D AAAGATAAAGTTAAGTGTTTGTAG CTACAAACACTTAACTTTATCTTT
89 MTAG-B089 Luminex 100/200 and FLEXMAP 3D TAGATAATGTGAAGTAATAAGTGA TCACTTATTACTTCACATTATCTA
90 MTAG-B090 Luminex 100/200 and FLEXMAP 3D TAGATTAGTTGATAAGTGTGTAAT ATTACACACTTATCAACTAATCTA
91 MTAG-B091 Luminex 100/200 and FLEXMAP 3D GTTTAGTGATTAAAGATAGATTAG CTAATCTATCTTTAATCACTAAAC
92 MTAG-C092 FLEXMAP 3D Only AGATAAAGAGATTTAAGATGTATG CATACATCTTAAATCTCTTTATCT
93 MTAG-B093 Luminex 100/200 and FLEXMAP 3D AGAGAGTTTGTGTATATGTATAAA TTTATACATATACACAAACTCTCT
94 MTAG-B094 Luminex 100/200 and FLEXMAP 3D GTAGTAAAGAGAATTGTTTAGTAT ATACTAAACAATTCTCTTTACTAC
95 MTAG-B095 Luminex 100/200 and FLEXMAP 3D TGATGTGATAATGAGAATAAAGAA TTCTTTATTCTCATTATCACATCA
96 MTAG-B096 Luminex 100/200 and FLEXMAP 3D TATGTGTATGAAGATTATAGTTAG CTAACTATAATCTTCATACACATA
97 MTAG-B097 Luminex 100/200 and FLEXMAP 3D TGAAATAGAAGTGAGATTATAGTA TACTATAATCTCACTTCTATTTCA
98 MTAG-B098 Luminex 100/200 and FLEXMAP 3D AAATGTGTGTTTAGTAGTTGTAAA TTTACAACTACTAAACACACATTT
99 MTAG-B099 Luminex 100/200 and FLEXMAP 3D GTTAGAATGTATATAGAGTTAGAT ATCTAACTCTATATACATTCTAAC
100 MTAG-B100 Luminex 100/200 and FLEXMAP 3D TTAAGAAGAATTGTATATGAGAGT ACTCTCATATACAATTCTTCTTAA
101 MTAG-C101 FLEXMAP 3D Only TTTAGAGTTTGATTAGTATGTTTG CAAACATACTAATCAAACTCTAAA
102 MTAG-C102 FLEXMAP 3D Only AATGAATAGAATAGAGAATGTAGA TCTACATTCTCTATTCTATTCATT
103 MTAG-C103 FLEXMAP 3D Only GATGTATAATGATGTGTGTAAATT AATTTACACACATCATTATACATC
104 MTAG-C104 FLEXMAP 3D Only TAAAGAGTGATGTAAATAGAAGTT AACTTCTATTTACATCACTCTTTA
105 MTAG-C105 FLEXMAP 3D Only TGTAGTGTTTAGAGTAAGTTATTA TAATAACTTACTCTAAACACTACA
106 MTAG-C106 FLEXMAP 3D Only GTAATAAGTTGTGAAAGAAGATTA TAATCTTCTTTCACAACTTATTAC
107 MTAG-C107 FLEXMAP 3D Only TTTAGTTGATTGTTGAATAGAGTA TACTCTATTCAACAATCAACTAAA
108 MTAG-C108 FLEXMAP 3D Only ATTATTGAAAGTAGATGTTAGATG CATCTAACATCTACTTTCAATAAT
109 MTAG-C109 FLEXMAP 3D Only TTTATGTGTGATTGAGTGTTTAAT ATTAAACACTCAATCACACATAAA
110 MTAG-C110 FLEXMAP 3D Only TATTTAGTTAGATAGATAGAGAGT ACTCTCTATCTATCTAACTAAATA
111 MTAG-C111 FLEXMAP 3D Only ATGTGTTTATGTGAAAGATTTGTA TACAAATCTTTCACATAAACACAT
112 MTAG-C112 FLEXMAP 3D Only TATGAGTGATTAGAATTGTATTTG CAAATACAATTCTAATCACTCATA
113 MTAG-C113 FLEXMAP 3D Only TTAATGTATTGTTTAAAGAGTGTG CACACTCTTTAAACAATACATTAA
114 MTAG-C114 FLEXMAP 3D Only GTTATAAGTAGAAATGTATAGAAG CTTCTATACATTTCTACTTATAAC
115 MTAG-C115 FLEXMAP 3D Only GAGAATGTTGAATAAGAAGTAATT AATTACTTCTTATTCAACATTCTC
116 MTAG-C116 FLEXMAP 3D Only AGTTATAAGTAAATGATGTTGATG CATCAACATCATTTACTTATAACT
117 MTAG-C117 FLEXMAP 3D Only TTGTATGTGAGTTTAGATTAATGA TCATTAATCTAAACTCACATACAA
118 MTAG-C118 FLEXMAP 3D Only TAGTTAAAGTATAGTTGTTTGAGT ACTCAAACAACTATACTTTAACTA
119 MTAG-C119 FLEXMAP 3D Only AAATTTGTGTTGAGATTTGTATAG CTATACAAATCTCAACACAAATTT
120 MTAG-C120 FLEXMAP 3D Only TATAAGAAGTAATTTGAGAAGAGT ACTCTTCTCAAATTACTTCTTATA
121 MTAG-C121 FLEXMAP 3D Only TTTGATTTATGTGTTATGTTGAGT ACTCAACATAACACATAAATCAAA
122 MTAG-C122 FLEXMAP 3D Only AGATTGAAATAGATTAGAAAGTTG CAACTTTCTAATCTATTTCAATCT
123 MTAG-C123 FLEXMAP 3D Only GTTGTTATAAGAAATAGTTTGTTG CAACAAACTATTTCTTATAACAAC
124 MTAG-C124 FLEXMAP 3D Only AAGAAGTAAGAGAGAAATTTGAAT ATTCAAATTTCTCTCTTACTTCTT
125 MTAG-C125 FLEXMAP 3D Only AGATAAGTTAAAGTAAAGAGAATG CATTCTCTTTACTTTAACTTATCT
126 MTAG-C126 FLEXMAP 3D Only TAGTTGAAGTTAGTTTAAGTGTTA TAACACTTAAACTAACTTCAACTA
127 MTAG-C127 FLEXMAP 3D Only AGTAAGAATGTAATATGATGATAG CTATCATCATATTACATTCTTACT
128 MTAG-C128 FLEXMAP 3D Only AGTTAGTAAGAGAATATAGTGAAT ATTCACTATATTCTCTTACTAACT
129 MTAG-C129 FLEXMAP 3D Only ATTGTGTTTAAGAAATATGATGAG CTCATCATATTTCTTAAACACAAT
130 MTAG-C130 FLEXMAP 3D Only ATTTGTGTGATGTTTGAAATATGA TCATATTTCAAACATCACACAAAT
131 MTAG-C131 FLEXMAP 3D Only AGAGAAATTGAATTTAGAAATGTG CACATTTCTAAATTCAATTTCTCT
132 MTAG-C132 FLEXMAP 3D Only TTAGAAGATAGATTATTGAGAAAG CTTTCTCAATAATCTATCTTCTAA
133 MTAG-C133 FLEXMAP 3D Only AGTAAGAAAGTTTAGTTTAGTTAG CTAACTAAACTAAACTTTCTTACT
134 MTAG-C134 FLEXMAP 3D Only TTAGATTAGAGTAGTAGAAGAATA TATTCTTCTACTACTCTAATCTAA
135 MTAG-C135 FLEXMAP 3D Only TTAAAGATGTTAAAGAATGAGTGA TCACTCATTCTTTAACATCTTTAA
136 MTAG-C136 FLEXMAP 3D Only TGTAGTATGAAGAATAATGAAATG CATTTCATTATTCTTCATACTACA
137 MTAG-C137 FLEXMAP 3D Only ATTTAGAGTTGTAAGAAGATATTG CAATATCTTCTTACAACTCTAAAT
138 MTAG-C138 FLEXMAP 3D Only GAGAAATTGTAATTGTTAGAGTAT ATACTCTAACAATTACAATTTCTC
139 MTAG-C139 FLEXMAP 3D Only AATATTGAAGATGTAGTGAGTTAT ATAACTCACTACATCTTCAATATT
140 MTAG-C140 FLEXMAP 3D Only GAGTTTAGAAATGATAAAGAATTG CAATTCTTTATCATTTCTAAACTC
141 MTAG-C141 FLEXMAP 3D Only TGAGTAAATAGTTTATGAGTAGTA TACTACTCATAAACTATTTACTCA
142 MTAG-C142 FLEXMAP 3D Only TTTAGTTTGATGTGTTTATGAGAT ATCTCATAAACACATCAAACTAAA
143 MTAG-C143 FLEXMAP 3D Only TAGTTGAATAAGATTGAGAGAAAT ATTTCTCTCAATCTTATTCAACTA
144 MTAG-C144 FLEXMAP 3D Only TTAAGTGAAGTGTTGTTTATTGAA TTCAATAAACAACACTTCACTTAA
145 MTAG-C145 FLEXMAP 3D Only ATTGATTTGTTGAAATAAGTGTTG CAACACTTATTTCAACAAATCAAT
146 MTAG-C146 FLEXMAP 3D Only TGAATTGTTGATAAGTTATGAAGA ;TCTTCATAACTTATCAACAATTCA
147 MTAG-C147 FLEXMAP 3D Only TGATTTAGTATGTATTAGAGTTGA TCAACTCTAATACATACTAAATCA
148 MTAG-C148 FLEXMAP 3D Only ATTTATGTAGTTGAGAGTGATAAA TTTATCACTCTCAACTACATAAAT
149 MTAG-C149 FLEXMAP 3D Only GTAAAGATAGTTTGAGTAATTTGA TCAAATTACTCAAACTATCTTTAC
150 MTAG-C150 FLEXMAP 3D Only GAAATAGTATAATGTTAAGTGAGA TCTCACTTAACATTATACTATTTC