MagPlex-TAG™ Microspheres

MagPlex-TAG Microspheres are oligonucleotide-coupled polystyrene micro-particles, or “beads,” that have been dyed into spectrally distinct sets, or “regions”; allowing them to be individually identified by an xMAP Instrument. Each one of these uniquely color-coded beads has a unique 24 base DNA sequence, called an “anti-TAG,” covalently coupled to its surface. These beads enable the user to quickly and easily design custom bead arrays, simply by adding a complementary “TAG” sequence to their primers or probes of interest and hybridizing those primers or probes to the anti-TAG sequence on the addressable microsphere.

For a complete list of the TAG and anti-TAG sequences for each of the 150 available microspheres, please see the Ordering tab below, or download the MagPlex-TAG Product Information Sheet.

IMPORTANT: MagPlex-TAG microspheres require the use of xPONENT® software.

IMPORTANT: MagPlex-TAG Group C regions are built-to-order. Please contact your Luminex representative to inquire about minimum order requirements and lead times for these regions.

magplex-tag-regions.jpgClick For More Information

Overview

magplex-tag-image.jpg

MagPlex-TAG Microspheres are magnetic, allowing them to be easily separated from solution with the use of a magnetic separator; dramatically improving percent recovery during handling and wash steps and facilitating assay automation. Additionally, MagPlex-TAG Microspheres are compatible with all xMAP Instruments, including the latest MAGPIX® system. MAGPIX is simple and easy to use, has a small foot print, and the most economical multiplex instrument on the market.

All microspheres are general use components for further manufacture of xMAP bioassays. MagPlex-TAG Microspheres are available at a concentration of 2.5 million beads/mL and can be ordered in 1mL vial sizes only. Please contact Luminex to inquire about custom vial sizes.

Features

  • 150 Unique 24mer surface anti-TAG DNA sequences
  • 150 Regions available (each with unique anti-TAG®)
  • Compatible with all xMAP Instruments
  • 1mL vial size
  • 2.5 million beads/mL concentration

Benefits

  • Proven xTAG technology
  • Increased multiplex capability
  • Improved washing efficiency
  • Ideal for automated applications
  • No need for expensive filter plates
  • Convenient 2.5 million bead/mL concentration for improved handling

 

IMPORTANT: MagPlex-TAG Group C regions are built-to-order. Please contact your Luminex representative to inquire about minimum order requirements and lead times for these regions.

Specifications

MagPlex-TAG Microspheres are provided in Tris-EDTA, pH 8.0, and consist of MagPlex Microspheres coupled to proprietary 24mer DNA oligonucleotide anti-TAG sequences. Product specifications are assured up to the expiration date stated on the label with proper handling and storage. The expiration date is intended to be the latest date at which the material should be used for further manufacture of a bioassay. Although continued conformance to specifications is expected subsequent to further manufacture of the microspheres, users must characterize and control their formulations to assure assay specific performance.

Recommended Hybridization Conditions

30 - 60 minutes at 37°C in 1X Hybridization Buffer (0.2M NaCl, 0.1 M Tris, 0.08% Triton X-100, pH 8.0)

PropertiesSpecification
Microsphere Concentration (microspheres/mL)2.5 x 106
MediumTris-EDTA, pH 8.0
Median Microsphere Density (g/mL)1.10 ± 0.06
Mode Microsphere Diameter (µm)6.5 ± 0.2
RP1 background≤ 100
Classification Efficiency> 80%
Misclassification≤ 2.0%
Doublet Discrimination Peak9,000 – 14,000

 

Storage

Store product upright at 2-8ºC dark. Avoid freezing. Avoid exposure to heat >55ºC for durations greater than 24 hours

For a complete list of specifications see the MagPlex-TAG Product Information Sheet and other product related documents in the Downloads section.

 Anti-TAG Sequence List

Bead RegionSequence Bound to Each MicrospherePart Number
1TATTATGAGAAAGTTGAATAGTAGMTAG-C001
2ATGAAAGTTAGAGTTTATGATAAGMTAG-C002
3AATAGATAAGATTGATTGTGTTTGMTAG-C003
4TGTTAAATGTATGTAGTAATTGAGMTAG-C004
5ATAGATTTAAGTGAAGAGAGTTATMTAG-C005
6GAATGTTTGTAAATGTATAGATAGMTAG-C006
7AAATTGTGAAAGATTGTTTGTGTAMTAG-B007
8TGTAAGTGAAATAGTGAGTTATTTMTAG-B008
9GAATTGTATAAAGTATTAGATGTGMTAG-B009
10AGTGAGATTATGAGTATTGATTTAMTAG-C010
11GTGTAAATGTTTGAGATGTATATTMTAG-C011
12AGTAGAAAGTTGAAATTGATTATGMTAG-A012
13AGTGAATGTAAGATTATGTATTTGMTAG-A013
14ATTGTGAAAGAAAGAGAAGAAATTMTAG-A014
15GTTGTAAATTGTAGTAAAGAAGTAMTAG-A015
16GTAGTAGTAATTTGAATGTTTGAAMTAG-C016
17TTGTGAATGATTAATGAATAGAAGMTAG-C017
18GTAATTGAATTGAAAGATAAGTGTMTAG-A018
19GTGTGTTATTTGTTTGTAAAGTATMTAG-A019
20AAATTAGTTGAAAGTATGAGAAAGMTAG-A020
21ATTAAGTAAGAATTGAGAGTTTGAMTAG-A021
22GATTGATATTTGAATGTTTGTTTGMTAG-A022
23TAGTGTAGATATTTGATAGTTATGMTAG-C023
24AATAATGTTGTGAAATAGATGTGAMTAG-C024
25GTATGTTGTAATGTATTAAGAAAGMTAG-A025
26TTTGATTTAAGAGTGTTGAATGTAMTAG-A026
27AAGATGATAGTTAAGTGTAAGTTAMTAG-A027
28GATAGATTTAGAATGAATTAAGTGMTAG-A028
29TTTAAGTGAGTTATAGAAGTAGTAMTAG-A029
30GTGTTATAGAAGTTAAATGTTAAGMTAG-A030
31TAAGAAATGAGTTATATGTTGAGAMTAG-C031
32AAGTGTTTAATGTAAGAGAATGAAMTAG-C032
33TATTAGAGTTTGAGAATAAGTAGTMTAG-A033
34TGATATAGTAGTGAAGAAATAAGTMTAG-A034
35AATAAGAGAATTGATATGAAGATGMTAG-A035
36TTGTGTAGTTAAGAGTTGTTTAATMTAG-A036
37TGTATATGTTAATGAGATGTTGTAMTAG-A037
38AGTAAGTGTTAGATAGTATTGAATMTAG-A038
39TTGTGATAGTAGTTAGATATTTGTMTAG-A039
40AATGTAGAGATTGTAGTGAATATTMTAG-C040
41ATGTAATTGTGAATAATGTATGTGMTAG-C041
42ATTTGTTATGATAAATGTGTAGTGMTAG-A042
43AAATAAGAATAGAGAGAGAAAGTTMTAG-A043
44AATGTAAAGTAAAGAAAGTGATGAMTAG-A044
45GTTAGTTATGATGAATATTGTGTAMTAG-A045
46GTGATTGAATAGTAGATTGTTTAAMTAG-A046
47TATTGTTGAATGTGTTTAAAGAGAMTAG-A047
48TATGAATGTTATTGTGTGTTGATTMTAG-A048
49TGTAAGTTTAAAGTAAGAAATGTGMTAG-B049
50AGAGATATTAGAATGTAAGAATAGMTAG-C050
51GATAAGAAAGTGAAATGTAAATTGMTAG-A051
52GTAAGATTAGAAGTTAATGAAGAAMTAG-A052
53GTTTGTGTTTGTATAAGTTGTTAAMTAG-A053
54TAGAGAAAGAGAGAATTGTATTAAMTAG-A054
55GAAGATATTGAAAGAATTTGATGTMTAG-A055
56AATTAGAAGTAAGTAGAGTTTAAGMTAG-A056
57AGAGTATTAGTAGTTATTGTAAGTMTAG-A057
58TGAGAATGTAAAGAATGTTTATTGMTAG-B058
59ATTTAAGTAAAGTGTAGAGATAAGMTAG-B059
60GTTATGTAGAGATGAAAGAAATTAMTAG-C060
61TATTAGAGAGAAATTGTAGAGATTMTAG-A061
62TGAAATGTGTATTTGTATGTTTAGMTAG-A062
63TTTGTTGTTAAGTATGTGATTTAGMTAG-A063
64ATGATGTGTTTGATTTGAATTGAAMTAG-A064
65TGAGTAAGTTTGTATGTTTAAGTAMTAG-A065
66GTAAGAGTATTGAAATTAGTAAGAMTAG-A066
67TTTGTGTGTTATTGTAATTGAGATMTAG-A067
68TATTTGATAAGAGAATGAAGAAGTMTAG-B068
69ATGAAAGATTTAGTTGTGAGATATMTAG-B069
70GATTAGTATTTAGTAGTAATAGAGMTAG-B070
71GTGATAGAATTTGTGTTTAATGAAMTAG-C071
72AATTGAGAAAGAGATAAATGATAGMTAG-A072
73GTTGAGAATTAGAATTTGATAAAGMTAG-A073
74AATGAAATAGTGTTAAATGAGTGTMTAG-A074
75TTTGTTAGAATGAGAAGATTTATGMTAG-A075
76AAAGAATTAGTATGATAGATGAGAMTAG-A076
77GTTATGATATAGTGAGTTGTTATTMTAG-A077
78GTATAGTGTGATTAGATTTGTAAAMTAG-A078
79TAGTAGAATTGTTGTTAAAGAATGMTAG-B079
80GATGAATATAGTAAGTATTGAGTAMTAG-B080
81GTGAATAATGAAGAAGTTATGTTAMTAG-B081
82ATTTGTATAAAGTGAAGAAGAGAAMTAG-B082
83GAAAGTTTAAGTGATGTATATTGTMTAG-B083
84TGAATTGAATAAGAATTTGTTGTGMTAG-B084
85GTTATGAAAGAGTATGTGTTAAATMTAG-B085
86GTGTGATTAGTAATGAAGTATTTAMTAG-B086
87GTTTGTTGAAAGTGTAAAGTATATMTAG-B087
88AAAGATAAAGTTAAGTGTTTGTAGMTAG-B088
89TAGATAATGTGAAGTAATAAGTGAMTAG-B089
90TAGATTAGTTGATAAGTGTGTAATMTAG-B090
91GTTTAGTGATTAAAGATAGATTAGMTAG-B091
92AGATAAAGAGATTTAAGATGTATGMTAG-C092
93AGAGAGTTTGTGTATATGTATAAAMTAG-B093
94GTAGTAAAGAGAATTGTTTAGTATMTAG-B094
95TGATGTGATAATGAGAATAAAGAAMTAG-B095
96TATGTGTATGAAGATTATAGTTAGMTAG-B096
97TGAAATAGAAGTGAGATTATAGTAMTAG-B097
98AAATGTGTGTTTAGTAGTTGTAAAMTAG-B098
99GTTAGAATGTATATAGAGTTAGATMTAG-B099
100TTAAGAAGAATTGTATATGAGAGTMTAG-B100
101TTTAGAGTTTGATTAGTATGTTTGMTAG-C101
102AATGAATAGAATAGAGAATGTAGAMTAG-C102
103GATGTATAATGATGTGTGTAAATTMTAG-C103
104TAAAGAGTGATGTAAATAGAAGTTMTAG-C104
105TGTAGTGTTTAGAGTAAGTTATTAMTAG-C105
106GTAATAAGTTGTGAAAGAAGATTAMTAG-C106
107TTTAGTTGATTGTTGAATAGAGTAMTAG-C107
108ATTATTGAAAGTAGATGTTAGATGMTAG-C108
109TTTATGTGTGATTGAGTGTTTAATMTAG-C109
110TATTTAGTTAGATAGATAGAGAGTMTAG-C110
111ATGTGTTTATGTGAAAGATTTGTAMTAG-C111
112TATGAGTGATTAGAATTGTATTTGMTAG-C112
113TTAATGTATTGTTTAAAGAGTGTGMTAG-C113
114GTTATAAGTAGAAATGTATAGAAGMTAG-C114
115GAGAATGTTGAATAAGAAGTAATTMTAG-C115
116AGTTATAAGTAAATGATGTTGATGMTAG-C116
117TTGTATGTGAGTTTAGATTAATGAMTAG-C117
118TAGTTAAAGTATAGTTGTTTGAGTMTAG-C118
119AAATTTGTGTTGAGATTTGTATAGMTAG-C119
120TATAAGAAGTAATTTGAGAAGAGTMTAG-C120
121TTTGATTTATGTGTTATGTTGAGTMTAG-C121
122AGATTGAAATAGATTAGAAAGTTGMTAG-C122
123GTTGTTATAAGAAATAGTTTGTTGMTAG-C123
124AAGAAGTAAGAGAGAAATTTGAATMTAG-C124
125AGATAAGTTAAAGTAAAGAGAATGMTAG-C125
126TAGTTGAAGTTAGTTTAAGTGTTAMTAG-C126
127AGTAAGAATGTAATATGATGATAGMTAG-C127
128AGTTAGTAAGAGAATATAGTGAATMTAG-C128
129ATTGTGTTTAAGAAATATGATGAGMTAG-C129
130ATTTGTGTGATGTTTGAAATATGAMTAG-C130
131AGAGAAATTGAATTTAGAAATGTGMTAG-C131
132TTAGAAGATAGATTATTGAGAAAGMTAG-C132
133AGTAAGAAAGTTTAGTTTAGTTAGMTAG-C133
134TTAGATTAGAGTAGTAGAAGAATAMTAG-C134
135TTAAAGATGTTAAAGAATGAGTGAMTAG-C135
136TGTAGTATGAAGAATAATGAAATGMTAG-C136
137ATTTAGAGTTGTAAGAAGATATTGMTAG-C137
138GAGAAATTGTAATTGTTAGAGTATMTAG-C138
139AATATTGAAGATGTAGTGAGTTATMTAG-C139
140GAGTTTAGAAATGATAAAGAATTGMTAG-C140
141TGAGTAAATAGTTTATGAGTAGTAMTAG-C141
142TTTAGTTTGATGTGTTTATGAGATMTAG-C142
143TAGTTGAATAAGATTGAGAGAAATMTAG-C143
144TTAAGTGAAGTGTTGTTTATTGAAMTAG-C144
145ATTGATTTGTTGAAATAAGTGTTGMTAG-C145
146TGAATTGTTGATAAGTTATGAAGAMTAG-C146
147TGATTTAGTATGTATTAGAGTTGAMTAG-C147
148ATTTATGTAGTTGAGAGTGATAAAMTAG-C148
149GTAAAGATAGTTTGAGTAATTTGAMTAG-C149
150GAAATAGTATAATGTTAAGTGAGAMTAG-C150

 

Ordering Information

Online Order Management
Email: [email protected]
Phone: 1-512-336-3550
Toll Free: 1-866-401-5450
Fax: 1-512-219-0544
Fax: 31-162-408330 (EMEA, India)

Reagent Shipping Policy
All MagPlex-TAG Microsphere orders, 1 ml volumes, will usually ship within 3 business days of order receipt.  However, back ordered items may have longer than normal lead times.  Group A and Group B regions have a guaranteed minimum shelf life of 6 month from the date of shipment and Group C regions have a guaranteed minimum shelf life of 3 month from the shipment date.  Please see the MagPlex Instrument Compatibility Guidelines for more information on region grouping. 

Part Numbers

To ensure maximum compatibility and availability, new assay developers should always begin with the Group A regions; moving into Group B then Group C regions only when necessary for higher-plex assays. 

IMPORTANT: MagPlex-TAG Group C regions are built-to-order. Please contact your Luminex representative to inquire about minimum order requirements and lead times for these regions.

Available in 1mL vial sizes only.  Please contact Luminex to inquire about custom vial sizes.

Reg. Part Number Instrument Compatibility Anti-TAG Sequence Bound to Each Microsphere (5' to 3') Complementary TAG Sequence  (5' to 3')
12 MTAG-A012 All xMAP Instruments AGTAGAAAGTTGAAATTGATTATG CATAATCAATTTCAACTTTCTACT
13 MTAG-A013 All xMAP Instruments AGTGAATGTAAGATTATGTATTTG CAAATACATAATCTTACATTCACT
14 MTAG-A014 All xMAP Instruments ATTGTGAAAGAAAGAGAAGAAATT AATTTCTTCTCTTTCTTTCACAAT
15 MTAG-A015 All xMAP Instruments GTTGTAAATTGTAGTAAAGAAGTA TACTTCTTTACTACAATTTACAAC
18 MTAG-A018 All xMAP Instruments GTAATTGAATTGAAAGATAAGTGT ACACTTATCTTTCAATTCAATTAC
19 MTAG-A019 All xMAP Instruments GTGTGTTATTTGTTTGTAAAGTAT ATACTTTACAAACAAATAACACAC
20 MTAG-A020 All xMAP Instruments AAATTAGTTGAAAGTATGAGAAAG CTTTCTCATACTTTCAACTAATTT
21 MTAG-A021 All xMAP Instruments ATTAAGTAAGAATTGAGAGTTTGA TCAAACTCTCAATTCTTACTTAAT
22 MTAG-A022 All xMAP Instruments GATTGATATTTGAATGTTTGTTTG CAAACAAACATTCAAATATCAATC
25 MTAG-A025 All xMAP Instruments GTATGTTGTAATGTATTAAGAAAG CTTTCTTAATACATTACAACATAC
26 MTAG-A026 All xMAP Instruments TTTGATTTAAGAGTGTTGAATGTA TACATTCAACACTCTTAAATCAAA
27 MTAG-A027 All xMAP Instruments AAGATGATAGTTAAGTGTAAGTTA TAACTTACACTTAACTATCATCTT
28 MTAG-A028 All xMAP Instruments GATAGATTTAGAATGAATTAAGTG CACTTAATTCATTCTAAATCTATC
29 MTAG-A029 All xMAP Instruments TTTAAGTGAGTTATAGAAGTAGTA TACTACTTCTATAACTCACTTAAA
30 MTAG-A030 All xMAP Instruments GTGTTATAGAAGTTAAATGTTAAG CTTAACATTTAACTTCTATAACAC
33 MTAG-A033 All xMAP Instruments TATTAGAGTTTGAGAATAAGTAGT ACTACTTATTCTCAAACTCTAATA
34 MTAG-A034 All xMAP Instruments TGATATAGTAGTGAAGAAATAAGT ACTTATTTCTTCACTACTATATCA
35 MTAG-A035 All xMAP Instruments AATAAGAGAATTGATATGAAGATG CATCTTCATATCAATTCTCTTATT
36 MTAG-A036 All xMAP Instruments TTGTGTAGTTAAGAGTTGTTTAAT ATTAAACAACTCTTAACTACACAA
37 MTAG-A037 All xMAP Instruments TGTATATGTTAATGAGATGTTGTA TACAACATCTCATTAACATATACA
38 MTAG-A038 All xMAP Instruments AGTAAGTGTTAGATAGTATTGAAT ATTCAATACTATCTAACACTTACT
39 MTAG-A039 All xMAP Instruments TTGTGATAGTAGTTAGATATTTGT ACAAATATCTAACTACTATCACAA
42 MTAG-A042 All xMAP Instruments ATTTGTTATGATAAATGTGTAGTG CACTACACATTTATCATAACAAAT
43 MTAG-A043 All xMAP Instruments AAATAAGAATAGAGAGAGAAAGTT AACTTTCTCTCTCTATTCTTATTT
44 MTAG-A044 All xMAP Instruments AATGTAAAGTAAAGAAAGTGATGA TCATCACTTTCTTTACTTTACATT
45 MTAG-A045 All xMAP Instruments GTTAGTTATGATGAATATTGTGTA TACACAATATTCATCATAACTAAC
46 MTAG-A046 All xMAP Instruments GTGATTGAATAGTAGATTGTTTAA TTAAACAATCTACTATTCAATCAC
47 MTAG-A047 All xMAP Instruments TATTGTTGAATGTGTTTAAAGAGA TCTCTTTAAACACATTCAACAATA
48 MTAG-A048 All xMAP Instruments TATGAATGTTATTGTGTGTTGATT AATCAACACACAATAACATTCATA
51 MTAG-A051 All xMAP Instruments GATAAGAAAGTGAAATGTAAATTG CAATTTACATTTCACTTTCTTATC
52 MTAG-A052 All xMAP Instruments GTAAGATTAGAAGTTAATGAAGAA TTCTTCATTAACTTCTAATCTTAC
53 MTAG-A053 All xMAP Instruments GTTTGTGTTTGTATAAGTTGTTAA TTAACAACTTATACAAACACAAAC
54 MTAG-A054 All xMAP Instruments TAGAGAAAGAGAGAATTGTATTAA TTAATACAATTCTCTCTTTCTCTA
55 MTAG-A055 All xMAP Instruments GAAGATATTGAAAGAATTTGATGT ACATCAAATTCTTTCAATATCTTC
56 MTAG-A056 All xMAP Instruments AATTAGAAGTAAGTAGAGTTTAAG CTTAAACTCTACTTACTTCTAATT
57 MTAG-A057 All xMAP Instruments AGAGTATTAGTAGTTATTGTAAGT ACTTACAATAACTACTAATACTCT
61 MTAG-A061 All xMAP Instruments TATTAGAGAGAAATTGTAGAGATT AATCTCTACAATTTCTCTCTAATA
62 MTAG-A062 All xMAP Instruments TGAAATGTGTATTTGTATGTTTAG CTAAACATACAAATACACATTTCA
63 MTAG-A063 All xMAP Instruments TTTGTTGTTAAGTATGTGATTTAG CTAAATCACATACTTAACAACAAA
64 MTAG-A064 All xMAP Instruments ATGATGTGTTTGATTTGAATTGAA TTCAATTCAAATCAAACACATCAT
65 MTAG-A065 All xMAP Instruments TGAGTAAGTTTGTATGTTTAAGTA TACTTAAACATACAAACTTACTCA
66 MTAG-A066 All xMAP Instruments GTAAGAGTATTGAAATTAGTAAGA TCTTACTAATTTCAATACTCTTAC
67 MTAG-A067 All xMAP Instruments TTTGTGTGTTATTGTAATTGAGAT ATCTCAATTACAATAACACACAAA
72 MTAG-A072 All xMAP Instruments AATTGAGAAAGAGATAAATGATAG CTATCATTTATCTCTTTCTCAATT
73 MTAG-A073 All xMAP Instruments GTTGAGAATTAGAATTTGATAAAG CTTTATCAAATTCTAATTCTCAAC
74 MTAG-A074 All xMAP Instruments AATGAAATAGTGTTAAATGAGTGT ACACTCATTTAACACTATTTCATT
75 MTAG-A075 All xMAP Instruments TTTGTTAGAATGAGAAGATTTATG CATAAATCTTCTCATTCTAACAAA
76 MTAG-A076 All xMAP Instruments AAAGAATTAGTATGATAGATGAGA TCTCATCTATCATACTAATTCTTT
77 MTAG-A077 All xMAP Instruments GTTATGATATAGTGAGTTGTTATT AATAACAACTCACTATATCATAAC
78 MTAG-A078 All xMAP Instruments GTATAGTGTGATTAGATTTGTAAA TTTACAAATCTAATCACACTATAC
7 MTAG-B007 Luminex 100/200 and FLEXMAP 3D AAATTGTGAAAGATTGTTTGTGTA TACACAAACAATCTTTCACAATTT
8 MTAG-B008 Luminex 100/200 and FLEXMAP 3D TGTAAGTGAAATAGTGAGTTATTT  AAATAACTCACTATTTCACTTACA
9 MTAG-B009 Luminex 100/200 and FLEXMAP 3D GAATTGTATAAAGTATTAGATGTG  CACATCTAATACTTTATACAATTC
49 MTAG-B049 Luminex 100/200 and FLEXMAP 3D TGTAAGTTTAAAGTAAGAAATGTG  CACATTTCTTACTTTAAACTTACA
58 MTAG-B058 Luminex 100/200 and FLEXMAP 3D TGAGAATGTAAAGAATGTTTATTG  CAATAAACATTCTTTACATTCTCA
59 MTAG-B059 Luminex 100/200 and FLEXMAP 3D ATTTAAGTAAAGTGTAGAGATAAG  CTTATCTCTACACTTTACTTAAAT
68 MTAG-B068 Luminex 100/200 and FLEXMAP 3D TATTTGATAAGAGAATGAAGAAGT  ACTTCTTCATTCTCTTATCAAATA
69 MTAG-B069 Luminex 100/200 and FLEXMAP 3D ATGAAAGATTTAGTTGTGAGATAT  ATATCTCACAACTAAATCTTTCAT
70 MTAG-B070 Luminex 100/200 and FLEXMAP 3D GATTAGTATTTAGTAGTAATAGAG  CTCTATTACTACTAAATACTAATC
79 MTAG-B079 Luminex 100/200 and FLEXMAP 3D TAGTAGAATTGTTGTTAAAGAATG  CATTCTTTAACAACAATTCTACTA
80 MTAG-B080 Luminex 100/200 and FLEXMAP 3D GATGAATATAGTAAGTATTGAGTA  TACTCAATACTTACTATATTCATC
81 MTAG-B081 Luminex 100/200 and FLEXMAP 3D GTGAATAATGAAGAAGTTATGTTA  TAACATAACTTCTTCATTATTCAC
82 MTAG-B082 Luminex 100/200 and FLEXMAP 3D ATTTGTATAAAGTGAAGAAGAGAA  TTCTCTTCTTCACTTTATACAAAT
83 MTAG-B083 Luminex 100/200 and FLEXMAP 3D GAAAGTTTAAGTGATGTATATTGT  ACAATATACATCACTTAAACTTTC
84 MTAG-B084 Luminex 100/200 and FLEXMAP 3D TGAATTGAATAAGAATTTGTTGTG  CACAACAAATTCTTATTCAATTCA
85 MTAG-B085 Luminex 100/200 and FLEXMAP 3D GTTATGAAAGAGTATGTGTTAAAT  ATTTAACACATACTCTTTCATAAC
86 MTAG-B086 Luminex 100/200 and FLEXMAP 3D GTGTGATTAGTAATGAAGTATTTA  TAAATACTTCATTACTAATCACAC
87 MTAG-B087 Luminex 100/200 and FLEXMAP 3D GTTTGTTGAAAGTGTAAAGTATAT  ATATACTTTACACTTTCAACAAAC
88 MTAG-B088 Luminex 100/200 and FLEXMAP 3D AAAGATAAAGTTAAGTGTTTGTAG  CTACAAACACTTAACTTTATCTTT
89 MTAG-B089 Luminex 100/200 and FLEXMAP 3D TAGATAATGTGAAGTAATAAGTGA  TCACTTATTACTTCACATTATCTA
90 MTAG-B090 Luminex 100/200 and FLEXMAP 3D TAGATTAGTTGATAAGTGTGTAAT  ATTACACACTTATCAACTAATCTA
91 MTAG-B091 Luminex 100/200 and FLEXMAP 3D GTTTAGTGATTAAAGATAGATTAG  CTAATCTATCTTTAATCACTAAAC
93 MTAG-B093 Luminex 100/200 and FLEXMAP 3D AGAGAGTTTGTGTATATGTATAAA  TTTATACATATACACAAACTCTCT
94 MTAG-B094 Luminex 100/200 and FLEXMAP 3D GTAGTAAAGAGAATTGTTTAGTAT  ATACTAAACAATTCTCTTTACTAC
95 MTAG-B095 Luminex 100/200 and FLEXMAP 3D TGATGTGATAATGAGAATAAAGAA  TTCTTTATTCTCATTATCACATCA
96 MTAG-B096 Luminex 100/200 and FLEXMAP 3D TATGTGTATGAAGATTATAGTTAG  CTAACTATAATCTTCATACACATA
97 MTAG-B097 Luminex 100/200 and FLEXMAP 3D TGAAATAGAAGTGAGATTATAGTA  TACTATAATCTCACTTCTATTTCA
98 MTAG-B098 Luminex 100/200 and FLEXMAP 3D AAATGTGTGTTTAGTAGTTGTAAA  TTTACAACTACTAAACACACATTT
99 MTAG-B099 Luminex 100/200 and FLEXMAP 3D GTTAGAATGTATATAGAGTTAGAT  ATCTAACTCTATATACATTCTAAC
100 MTAG-B100 Luminex 100/200 and FLEXMAP 3D TTAAGAAGAATTGTATATGAGAGT  ACTCTCATATACAATTCTTCTTAA
1 MTAG-C001 FLEXMAP 3D Only TATTATGAGAAAGTTGAATAGTAG  CTACTATTCAACTTTCTCATAATA
2 MTAG-C002 FLEXMAP 3D Only TATTATGAGAAAGTTGAATAGTAG  CTTATCATAAACTCTAACTTTCAT
3 MTAG-C003 FLEXMAP 3D Only AATAGATAAGATTGATTGTGTTTG  CAAACACAATCAATCTTATCTATT
4 MTAG-C004 FLEXMAP 3D Only TGTTAAATGTATGTAGTAATTGAG  CTCAATTACTACATACATTTAACA
5 MTAG-C005 FLEXMAP 3D Only ATAGATTTAAGTGAAGAGAGTTAT  ATAACTCTCTTCACTTAAATCTAT
6 MTAG-C006 FLEXMAP 3D Only GAATGTTTGTAAATGTATAGATAG  CTATCTATACATTTACAAACATTC
10 MTAG-C010 FLEXMAP 3D Only AGTGAGATTATGAGTATTGATTTA  TAAATCAATACTCATAATCTCACT
11 MTAG-C011 FLEXMAP 3D Only GTGTAAATGTTTGAGATGTATATT  AATATACATCTCAAACATTTACAC
16 MTAG-C016 FLEXMAP 3D Only GTAGTAGTAATTTGAATGTTTGAA  TTCAAACATTCAAATTACTACTAC
17 MTAG-C017 FLEXMAP 3D Only TTGTGAATGATTAATGAATAGAAG  CTTCTATTCATTAATCATTCACAA
23 MTAG-C023 FLEXMAP 3D Only TAGTGTAGATATTTGATAGTTATG  CATAACTATCAAATATCTACACTA
24 MTAG-C024 FLEXMAP 3D Only AATAATGTTGTGAAATAGATGTGA  TCACATCTATTTCACAACATTATT
31 MTAG-C031 FLEXMAP 3D Only TAAGAAATGAGTTATATGTTGAGA  TCTCAACATATAACTCATTTCTTA
32 MTAG-C032 FLEXMAP 3D Only AAGTGTTTAATGTAAGAGAATGAA  TTCATTCTCTTACATTAAACACTT
40 MTAG-C040 FLEXMAP 3D Only AATGTAGAGATTGTAGTGAATATT  AATATTCACTACAATCTCTACATT
41 MTAG-C041 FLEXMAP 3D Only ATGTAATTGTGAATAATGTATGTG  CACATACATTATTCACAATTACAT
50 MTAG-C050 FLEXMAP 3D Only AGAGATATTAGAATGTAAGAATAG  CTATTCTTACATTCTAATATCTCT
60 MTAG-C060 FLEXMAP 3D Only GTTATGTAGAGATGAAAGAAATTA TAATTTCTTTCATCTCTACATAAC
71 MTAG-C071 FLEXMAP 3D Only GTGATAGAATTTGTGTTTAATGAA TTCATTAAACACAAATTCTATCAC
92 MTAG-C092 FLEXMAP 3D Only AGATAAAGAGATTTAAGATGTATG CATACATCTTAAATCTCTTTATCT
101 MTAG-C101 FLEXMAP 3D Only  TTTAGAGTTTGATTAGTATGTTTG  CAAACATACTAATCAAACTCTAAA
102 MTAG-C102 FLEXMAP 3D Only  AATGAATAGAATAGAGAATGTAGA TCTACATTCTCTATTCTATTCATT
103 MTAG-C103 FLEXMAP 3D Only  GATGTATAATGATGTGTGTAAATT  AATTTACACACATCATTATACATC
104 MTAG-C104 FLEXMAP 3D Only TAAAGAGTGATGTAAATAGAAGTT  AACTTCTATTTACATCACTCTTTA
105 MTAG-C105 FLEXMAP 3D Only TGTAGTGTTTAGAGTAAGTTATTA  TAATAACTTACTCTAAACACTACA
106 MTAG-C106 FLEXMAP 3D Only  GTAATAAGTTGTGAAAGAAGATTA  TAATCTTCTTTCACAACTTATTAC
107 MTAG-C107 FLEXMAP 3D Only  TTTAGTTGATTGTTGAATAGAGTA  TACTCTATTCAACAATCAACTAAA
108 MTAG-C108 FLEXMAP 3D Only ATTATTGAAAGTAGATGTTAGATG  CATCTAACATCTACTTTCAATAAT
109 MTAG-C109 FLEXMAP 3D Only TTTATGTGTGATTGAGTGTTTAAT  ATTAAACACTCAATCACACATAAA
110 MTAG-C110 FLEXMAP 3D Only  TATTTAGTTAGATAGATAGAGAGT  ACTCTCTATCTATCTAACTAAATA
111 MTAG-C111 FLEXMAP 3D Only  ATGTGTTTATGTGAAAGATTTGTA  TACAAATCTTTCACATAAACACAT
112 MTAG-C112 FLEXMAP 3D Only TATGAGTGATTAGAATTGTATTTG  CAAATACAATTCTAATCACTCATA
113 MTAG-C113 FLEXMAP 3D Only TTAATGTATTGTTTAAAGAGTGTG  CACACTCTTTAAACAATACATTAA
114 MTAG-C114 FLEXMAP 3D Only  GTTATAAGTAGAAATGTATAGAAG  CTTCTATACATTTCTACTTATAAC
115 MTAG-C115 FLEXMAP 3D Only GAGAATGTTGAATAAGAAGTAATT  AATTACTTCTTATTCAACATTCTC
116 MTAG-C116 FLEXMAP 3D Only AGTTATAAGTAAATGATGTTGATG  CATCAACATCATTTACTTATAACT
117 MTAG-C117 FLEXMAP 3D Only  TTGTATGTGAGTTTAGATTAATGA  TCATTAATCTAAACTCACATACAA
118 MTAG-C118 FLEXMAP 3D Only  TAGTTAAAGTATAGTTGTTTGAGT  ACTCAAACAACTATACTTTAACTA
119 MTAG-C119 FLEXMAP 3D Only  AAATTTGTGTTGAGATTTGTATAG  CTATACAAATCTCAACACAAATTT
120 MTAG-C120 FLEXMAP 3D Only  TATAAGAAGTAATTTGAGAAGAGT  ACTCTTCTCAAATTACTTCTTATA
121 MTAG-C121 FLEXMAP 3D Only  TTTGATTTATGTGTTATGTTGAGT  ACTCAACATAACACATAAATCAAA
122 MTAG-C122 FLEXMAP 3D Only  AGATTGAAATAGATTAGAAAGTTG  CAACTTTCTAATCTATTTCAATCT
123 MTAG-C123 FLEXMAP 3D Only  GTTGTTATAAGAAATAGTTTGTTG  CAACAAACTATTTCTTATAACAAC
124 MTAG-C124 FLEXMAP 3D Only  AAGAAGTAAGAGAGAAATTTGAAT  ATTCAAATTTCTCTCTTACTTCTT
125 MTAG-C125 FLEXMAP 3D Only  AGATAAGTTAAAGTAAAGAGAATG  CATTCTCTTTACTTTAACTTATCT
126 MTAG-C126 FLEXMAP 3D Only  TAGTTGAAGTTAGTTTAAGTGTTA  TAACACTTAAACTAACTTCAACTA
127 MTAG-C127 FLEXMAP 3D Only  AGTAAGAATGTAATATGATGATAG  CTATCATCATATTACATTCTTACT
128 MTAG-C128 FLEXMAP 3D Only  AGTTAGTAAGAGAATATAGTGAAT  ATTCACTATATTCTCTTACTAACT
129 MTAG-C129 FLEXMAP 3D Only  ATTGTGTTTAAGAAATATGATGAG  CTCATCATATTTCTTAAACACAAT
130 MTAG-C130 FLEXMAP 3D Only  ATTTGTGTGATGTTTGAAATATGA  TCATATTTCAAACATCACACAAAT
131 MTAG-C131 FLEXMAP 3D Only  AGAGAAATTGAATTTAGAAATGTG  CACATTTCTAAATTCAATTTCTCT
132 MTAG-C132 FLEXMAP 3D Only  TTAGAAGATAGATTATTGAGAAAG  CTTTCTCAATAATCTATCTTCTAA
133 MTAG-C133 FLEXMAP 3D Only  AGTAAGAAAGTTTAGTTTAGTTAG  CTAACTAAACTAAACTTTCTTACT
134 MTAG-C134 FLEXMAP 3D Only  TTAGATTAGAGTAGTAGAAGAATA  TATTCTTCTACTACTCTAATCTAA
135 MTAG-C135 FLEXMAP 3D Only  TTAAAGATGTTAAAGAATGAGTGA  TCACTCATTCTTTAACATCTTTAA
136 MTAG-C136 FLEXMAP 3D Only  TGTAGTATGAAGAATAATGAAATG  CATTTCATTATTCTTCATACTACA
137 MTAG-C137 FLEXMAP 3D Only  ATTTAGAGTTGTAAGAAGATATTG  CAATATCTTCTTACAACTCTAAAT
138 MTAG-C138 FLEXMAP 3D Only  GAGAAATTGTAATTGTTAGAGTAT  ATACTCTAACAATTACAATTTCTC
139 MTAG-C139 FLEXMAP 3D Only  AATATTGAAGATGTAGTGAGTTAT  ATAACTCACTACATCTTCAATATT
140 MTAG-C140 FLEXMAP 3D Only  GAGTTTAGAAATGATAAAGAATTG  CAATTCTTTATCATTTCTAAACTC
141 MTAG-C141 FLEXMAP 3D Only  TGAGTAAATAGTTTATGAGTAGTA  TACTACTCATAAACTATTTACTCA
142 MTAG-C142 FLEXMAP 3D Only  TTTAGTTTGATGTGTTTATGAGAT  ATCTCATAAACACATCAAACTAAA
143 MTAG-C143 FLEXMAP 3D Only  TAGTTGAATAAGATTGAGAGAAAT  ATTTCTCTCAATCTTATTCAACTA
144 MTAG-C144 FLEXMAP 3D Only  TTAAGTGAAGTGTTGTTTATTGAA  TTCAATAAACAACACTTCACTTAA
145 MTAG-C145 FLEXMAP 3D Only  ATTGATTTGTTGAAATAAGTGTTG  CAACACTTATTTCAACAAATCAAT
146 MTAG-C146 FLEXMAP 3D Only  TGAATTGTTGATAAGTTATGAAGA  TCTTCATAACTTATCAACAATTCA
147 MTAG-C147 FLEXMAP 3D Only  TGATTTAGTATGTATTAGAGTTGA  TCAACTCTAATACATACTAAATCA
148 MTAG-C148 FLEXMAP 3D Only  ATTTATGTAGTTGAGAGTGATAAA  TTTATCACTCTCAACTACATAAAT
149 MTAG-C149 FLEXMAP 3D Only  GTAAAGATAGTTTGAGTAATTTGA  TCAAATTACTCAAACTATCTTTAC
150 MTAG-C150 FLEXMAP 3D Only  GAAATAGTATAATGTTAAGTGAGA  TCTCACTTAACATTATACTATTTC

 

 

Assay Development Tools

Building your own custom assays on the Luminex platform is a simple, easy process with our assay development tools. Purchase microsphere reagents from Luminex, supply oligos or proteins to coat the microspheres and follow our simple protocols to allow multiplexing of almost any assay needed by your lab.

MagPlex-TAG Microspheres Training Courses

At Luminex Learning, we offer online, live online, and classroom training options. To view a list of our course offerings, or to enroll in a course, please visit our training page.